Quick Order

Human CCL26/Eotaxin-3 Gene ORF cDNA clone expression plasmid, N-Flag tag

  • Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
DatasheetReviewsRelated ProductsProtocols
Human CCL26 cDNA Clone Product Information
NCBI RefSeq:NM_006072.4
RefSeq ORF Size:303 bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 26 with N terminal Flag tag.
Gene Synonym:IMAC, TSC-1, MIP-4a, SCYA26, MGC126714, MIP-4alpha
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-SP-Flag-CCL26
Restriction Site:KpnI + XbaI(6kb+0.3kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CCL26 qPCR primers for gene expression analysis, HP100584 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Flow cytometric analysis of Mouse IL6ST(CD130) expression on BABL/c splenocytes. Cells were stained with PE-conjugated anti-Mouse IL6ST(CD130) and FITC-conjugated anti-Mouse CD3. The dot plots were derived from gated events with the forward and side light-scatter characteristics of intact cells.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to the sites of inflammation via CC chemokine receptor 3 (CCR3), which is also expressed by several different cell types, including basophils, dendritic cells, smooth muscle cells, epithelial cells and fibroblasts. The sequence similarity between the three eotaxins is limited (<40%), but their functional properties are very similar. Eotaxin-1 and -2 are expressed by both haematopoietic and non-haematopoietic cells, but eotaxin-3 expression has been reported to be limited to non-haematopoietic cells. Interleukin (IL)-4 is the main inducer for eotaxin-3 expression, whereas eotaxin-1 is up-regulated by IL-4 and the proinflammatory cytokine tumour necrosis factor (TNF)-α. Eotaxin-3 is expressed in vascular endothelial cells and human dermal fibroblasts after IL-4 and IL-13 stimulation, and this is dependent upon the IL-4-/IL-13-specific transcription factor, signal transducers and activator of transcription (STAT)-6. Eotaxin-3 is expressed on the surface of IL-4-stimulated endothelial cells and promotes eosinophil transmigration.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Takahashi K, Imaeda H, Fujimoto T, et al. Regulation of eotaxin-3/CC chemokine ligand 26 expression by T helper type 2 cytokines in human colonic myofibroblasts. Clinical and Experimental Immunology. 2013;173(2):323-331.
  • Size / Price
    Catalog: HG10577-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"