Quick Order

Human CCL16 / HCC-4 / NCC4 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human CCL16 cDNA Clone Product Information
    NCBI RefSeq:NM_004590.2
    RefSeq ORF Size:363bp
    cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 16 with C terminal Flag tag.
    Gene Synonym:LEC, LMC, NCC4, CKb12, HCC-4, LCC-1, Mtn-1, NCC-4, SCYL4, ILINCK, SCYA16, MGC117051, CCL16
    Species:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCL16 qPCR primers for gene expression analysis, HP100512 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    CCL16, a chemokine poorly characterized at the functional level. Human CCL16 is a member of the CC family, and its gene maps to human chromosome 17q. In the mouse, only a pseudogene has been identified to date. CCL16 is a functional ligand for CCR1, CCR2, CCR5, and CCR8. Recombinant CCL16 demonstrated chemotactic activity on human monocytes and lymphocytes. Based on the ability of human chemokines to exert activity on and bind to murine receptors, the TSA mouse adenocarcinoma cell line was transfected with human CCL16 cDNA and, in comparison with other cytokines, was shown to be the faster inducer of systemic immune response due to massive, prompt infiltration of leukocytes.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Guiducci C, Di Carlo E, Parenza M, et al. Intralesional injection of adenovirus encoding CC chemokine ligand 16 inhibits mammary tumor growth and prevents metastatic-induced death after surgical removal of the treated primary tumor[J]. The Journal of Immunology, 2004, 172(7): 4026-4036.
  • Size / Price
    Catalog: HG10491-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"