MIP-5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10898-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MIP-5 Reagents
CRO Services
Product recommended

All MIP-5 Reagents
MIP-5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
342 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 15 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MIP-5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HCC-2 cDNA ORF Clone, Human;HMRP-2B cDNA ORF Clone, Human;LKN-1 cDNA ORF Clone, Human;LKN1 cDNA ORF Clone, Human;MIP-1 delta cDNA ORF Clone, Human;MIP-1D cDNA ORF Clone, Human;MIP-5 cDNA ORF Clone, Human;MRP-2B cDNA ORF Clone, Human;NCC-3 cDNA ORF Clone, Human;NCC3 cDNA ORF Clone, Human;SCYA15 cDNA ORF Clone, Human;SCYL3 cDNA ORF Clone, Human;SY15 cDNA ORF Clone, Human
MIP-5 Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 15 (CCL15), also known as leukotactin-1, MIP5, MIP1 and HCC-2, is a small cytokine belonging to the C-C chemokine family. CCL15 is prevantly expressed in liver, small intestine, colon, and in certain leukocytes and macrophages of the lung. It is chemotactic for neutrophils, monocytes, and lymphocytes and elicits its effects by binding to cell surface chemokine receptors like CCR1 and CCR3.

Full Name
chemokine (C-C motif) ligand 15
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Youn, et al. (1997) Molecular cloning of leukotactin-1: a novel human beta-chemokine, a chemoattractant for neutrophils, monocytes, and lymphocytes, and a potent agonist at CC chemokine receptors 1 and 3. J Immun. 159: 5201-5.
  • Coulin, et al. (1997) Characterization of macrophage inflammatory protein-5 / human CC cytokine-2, a member of the macrophage-inflammatory-protein family of chemokines. Europ J Biochem. 248: 507-15.
  •  

    CCL15/MIP-5/MIP-1 delta related areas, pathways, and other information

    info info
    添加购物车成功! 添加购物车失败!