Quick Order

Human CCL15 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CCL15 cDNA Clone Product Information
NCBI RefSeq:NM_004167.3
RefSeq ORF Size:342bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 15 with N terminal Myc tag.
Gene Synonym:LKN1, NCC3, SY15, HCC-2, Lkn-1, MIP-5, NCC-3, SCYL3, MIP-1d, SCYA15, HMRP-2B
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 15 (CCL15), also known as leukotactin-1, MIP5, MIP1 and HCC-2, is a small cytokine belonging to the C-C chemokine family. CCL15 is prevantly expressed in liver, small intestine, colon, and in certain leukocytes and macrophages of the lung. It is chemotactic for neutrophils, monocytes, and lymphocytes and elicits its effects by binding to cell surface chemokine receptors like CCR1 and CCR3.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Youn, et al. (1997) Molecular cloning of leukotactin-1: a novel human beta-chemokine, a chemoattractant for neutrophils, monocytes, and lymphocytes, and a potent agonist at CC chemokine receptors 1 and 3. J Immun. 159: 5201-5.
  • Coulin, et al. (1997) Characterization of macrophage inflammatory protein-5 / human CC cytokine-2, a member of the macrophage-inflammatory-protein family of chemokines. Europ J Biochem. 248: 507-15.
  •  

    CCL15/MIP-5/MIP-1 delta related areas, pathways, and other information

    Size / Price
    Catalog: HG10898-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"