Quick Order

Text Size:AAA

Human I-309/CCL1/TCA-3 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CCL1 cDNA Clone Product Information
NCBI RefSeq:NM_002981.1
RefSeq ORF Size:291bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 1 with C terminal Myc tag.
Gene Synonym:CCL1, P500, SISe, TCA3, I-309, SCYA1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.

References
  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • Size / Price
    Catalog: HG10057-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"