CCDC84 cDNA ORF Clone, Human, untagged

Cat: HG16202-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCDC84 Reagents
CRO Services
Product recommended

All CCDC84 Reagents
CCDC84 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Human coiled-coil domain containing 84.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCDC84 cDNA ORF Clone, Human, untagged Alternative Names
DLNB14 cDNA ORF Clone, Human
CCDC84 Background Information
Full Name
coiled-coil domain containing 84

CCDC84 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCDC84 cDNA ORF Clone in Cloning Vector, Mouse MG56152-U
CCDC84 cDNA ORF Clone, Mouse, untagged MG56152-UT
CCDC84 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56152-ACGLN
CCDC84 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56152-ACG
CCDC84 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG56152-ANG
CCDC84 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56152-ACR
CCDC84 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG56152-ANR
CCDC84 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG56152-CF
CCDC84 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG56152-NF
CCDC84 cDNA ORF Clone, Mouse, C-His tag MG56152-CH
CCDC84 cDNA ORF Clone, Mouse, N-His tag MG56152-NH
CCDC84 cDNA ORF Clone, Mouse, C-HA tag MG56152-CY
CCDC84 cDNA ORF Clone, Mouse, N-HA tag MG56152-NY
CCDC84 cDNA ORF Clone, Mouse, C-Myc tag MG56152-CM
CCDC84 cDNA ORF Clone, Mouse, N-Myc tag MG56152-NM

CCDC84 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCDC84 cDNA ORF Clone in Cloning Vector, Human HG16202-G
CCDC84 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16202-ACGLN
CCDC84 cDNA ORF Clone, Human, C-GFPSpark® tag HG16202-ACG
CCDC84 cDNA ORF Clone, Human, N-GFPSpark® tag HG16202-ANG
CCDC84 cDNA ORF Clone, Human, C-OFPSpark® tag HG16202-ACR
CCDC84 cDNA ORF Clone, Human, N-OFPSpark® tag HG16202-ANR
CCDC84 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16202-CF
CCDC84 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16202-NF
CCDC84 cDNA ORF Clone, Human, C-His tag HG16202-CH
CCDC84 cDNA ORF Clone, Human, N-His tag HG16202-NH
CCDC84 cDNA ORF Clone, Human, C-HA tag HG16202-CY
CCDC84 cDNA ORF Clone, Human, N-HA tag HG16202-NY
CCDC84 cDNA ORF Clone, Human, C-Myc tag HG16202-CM
CCDC84 cDNA ORF Clone, Human, N-Myc tag HG16202-NM
CCDC84 qPCR Primer Pairs, Human HP104968
info info
添加购物车成功! 添加购物车失败!