CCDC25 cDNA ORF Clone, Human, N-HA tag

Cat: HG15929-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCDC25 Reagents
CRO Services
Product recommended

All CCDC25 Reagents
CCDC25 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Human coiled-coil domain containing 25 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCDC25 Background Information
Full Name
coiled-coil domain containing 25

CCDC25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCDC25 cDNA ORF Clone in Cloning Vector, Mouse MG5A5715-U
CCDC25 cDNA ORF Clone, Mouse, untagged MG5A5715-UT
CCDC25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5715-ACGLN
CCDC25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5715-ACG
CCDC25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5715-ANG
CCDC25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5715-ACR
CCDC25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5715-ANR
CCDC25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5715-CF
CCDC25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5715-NF
CCDC25 cDNA ORF Clone, Mouse, C-His tag MG5A5715-CH
CCDC25 cDNA ORF Clone, Mouse, N-His tag MG5A5715-NH
CCDC25 cDNA ORF Clone, Mouse, C-HA tag MG5A5715-CY
CCDC25 cDNA ORF Clone, Mouse, N-HA tag MG5A5715-NY
CCDC25 cDNA ORF Clone, Mouse, C-Myc tag MG5A5715-CM
CCDC25 cDNA ORF Clone, Mouse, N-Myc tag MG5A5715-NM

CCDC25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCDC25 cDNA ORF Clone in Cloning Vector, Human HG15929-G
CCDC25 cDNA ORF Clone, Human, untagged HG15929-UT
CCDC25 cDNA ORF Clone, Human, C-GFPSpark® tag HG15929-ACG
CCDC25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15929-ACGLN
CCDC25 cDNA ORF Clone, Human, N-GFPSpark® tag HG15929-ANG
CCDC25 cDNA ORF Clone, Human, C-OFPSpark® tag HG15929-ACR
CCDC25 cDNA ORF Clone, Human, N-OFPSpark® tag HG15929-ANR
CCDC25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15929-CF
CCDC25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15929-NF
CCDC25 cDNA ORF Clone, Human, C-His tag HG15929-CH
CCDC25 cDNA ORF Clone, Human, N-His tag HG15929-NH
CCDC25 cDNA ORF Clone, Human, C-HA tag HG15929-CY
CCDC25 cDNA ORF Clone, Human, C-Myc tag HG15929-CM
CCDC25 cDNA ORF Clone, Human, N-Myc tag HG15929-NM
CCDC25 qPCR Primer Pairs, Human HP104518
info info
添加购物车成功! 添加购物车失败!