Quick Order

Text Size:AAA

Human CCDC134 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CCDC134 cDNA Clone Product Information
NCBI RefSeq:NM_024821.2
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Homo sapiens coiled-coil domain containing 134 with N terminal Myc tag.
Gene Synonym:FLJ22349, MGC21013, dJ821D11.3, CCDC134
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Human coiled-coil domain containing 134 (CCDC134) is a 229 amino acids secretory protein. Coiled-coil domain is a motif in which alpha-helix are coiled together. It has been found in many types of proteins, including transcription factors, intermediate filaments and certain tRNA synthetases. Many proteins containing such motif CCDC134 are involved in important biological functions. CCDC134 is also considered as a novel human MAPK-regulating protein that can inhibit the MAPK pathway. This protein significantly inhibite Elk1 transcriptional activity. The coiled-coil domain is a ubiquitous protein motif that is often involved in oligomerization.

References
  • Huang J, et al. (2007) CCDC134, a novel secretory protein, inhibits activation of ERK and JNK, but not p38 MAPK. Cellular and Molecular Life Sciences. 65(2): 338-49.
  • Kim S, et al. (2011) Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. Neurology. 76(1): 69-79.
  • Size / Price
    Catalog: HG13168-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"