CCDC12 cDNA ORF Clone, Human, untagged

Cat: HG15283-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCDC12 Reagents
CRO Services
Product recommended

All CCDC12 Reagents
CCDC12 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Human coiled-coil domain containing 12.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCDC12 Background Information
Full Name
coiled-coil domain containing 12

CCDC12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCDC12 cDNA ORF Clone in Cloning Vector, Mouse MG5A5221-U
CCDC12 cDNA ORF Clone, Mouse, untagged MG5A5221-UT
CCDC12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5221-ACGLN
CCDC12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5221-ACG
CCDC12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5221-ANG
CCDC12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5221-ACR
CCDC12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5221-ANR
CCDC12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5221-CF
CCDC12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5221-NF
CCDC12 cDNA ORF Clone, Mouse, C-His tag MG5A5221-CH
CCDC12 cDNA ORF Clone, Mouse, N-His tag MG5A5221-NH
CCDC12 cDNA ORF Clone, Mouse, C-HA tag MG5A5221-CY
CCDC12 cDNA ORF Clone, Mouse, N-HA tag MG5A5221-NY
CCDC12 cDNA ORF Clone, Mouse, C-Myc tag MG5A5221-CM
CCDC12 cDNA ORF Clone, Mouse, N-Myc tag MG5A5221-NM

CCDC12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCDC12 cDNA ORF Clone in Cloning Vector, Human HG15283-G
CCDC12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15283-ACGLN
CCDC12 cDNA ORF Clone, Human, C-GFPSpark® tag HG15283-ACG
CCDC12 cDNA ORF Clone, Human, N-GFPSpark® tag HG15283-ANG
CCDC12 cDNA ORF Clone, Human, C-OFPSpark® tag HG15283-ACR
CCDC12 cDNA ORF Clone, Human, N-OFPSpark® tag HG15283-ANR
CCDC12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15283-CF
CCDC12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15283-NF
CCDC12 cDNA ORF Clone, Human, C-His tag HG15283-CH
CCDC12 cDNA ORF Clone, Human, N-His tag HG15283-NH
CCDC12 cDNA ORF Clone, Human, C-HA tag HG15283-CY
CCDC12 cDNA ORF Clone, Human, N-HA tag HG15283-NY
CCDC12 cDNA ORF Clone, Human, C-Myc tag HG15283-CM
CCDC12 cDNA ORF Clone, Human, N-Myc tag HG15283-NM
CCDC12 qPCR Primer Pairs, Human HP103909
info info
添加购物车成功! 添加购物车失败!