CBX6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14753-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CBX6 Reagents
CRO Services
Product recommended

All CBX6 Reagents
CBX6 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Human chromobox homolog 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CBX6 Background Information
Full Name
chromobox 6

CBX6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CBX6 cDNA ORF Clone in Cloning Vector, Rat RG8A1089-U
CBX6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1089-ACGLN

CBX6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CBX6 cDNA ORF Clone in Cloning Vector, Mouse MG5A4352-U
CBX6 cDNA ORF Clone, Mouse, untagged MG5A4352-UT
CBX6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4352-ACGLN
CBX6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4352-ACG
CBX6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4352-ANG
CBX6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4352-ACR
CBX6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4352-ANR
CBX6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4352-CF
CBX6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4352-NF
CBX6 cDNA ORF Clone, Mouse, C-His tag MG5A4352-CH
CBX6 cDNA ORF Clone, Mouse, N-His tag MG5A4352-NH
CBX6 cDNA ORF Clone, Mouse, C-HA tag MG5A4352-CY
CBX6 cDNA ORF Clone, Mouse, N-HA tag MG5A4352-NY
CBX6 cDNA ORF Clone, Mouse, C-Myc tag MG5A4352-CM
CBX6 cDNA ORF Clone, Mouse, N-Myc tag MG5A4352-NM

CBX6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CBX6 cDNA ORF Clone in Cloning Vector, Human HG14753-G
CBX6 cDNA ORF Clone, Human, untagged HG14753-UT
CBX6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14753-ACGLN
CBX6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14753-ACG
CBX6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14753-ANG
CBX6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14753-ACR
CBX6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14753-ANR
CBX6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14753-CF
CBX6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14753-NF
CBX6 cDNA ORF Clone, Human, C-His tag HG14753-CH
CBX6 cDNA ORF Clone, Human, N-His tag HG14753-NH
CBX6 cDNA ORF Clone, Human, C-HA tag HG14753-CY
CBX6 cDNA ORF Clone, Human, N-HA tag HG14753-NY
CBX6 cDNA ORF Clone, Human, N-Myc tag HG14753-NM
CBX6 qPCR Primer Pairs, Human HP103386
info info
添加购物车成功! 添加购物车失败!