Cystathionine beta-synthase cDNA ORF Clone, Human, untagged

Cat: HG14286-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cystathionine beta-synthase Reagents
CRO Services
Product recommended

All Cystathionine beta-synthase Reagents
Cystathionine beta-synthase cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1656 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cystathionine-beta-synthase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.66kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Cystathionine beta-synthase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystathionine beta-synthase cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Cystathionine beta-synthase cDNA ORF Clone, Human, untagged Alternative Names
HIP4 cDNA ORF Clone, Human
Cystathionine beta-synthase Background Information
Full Name
cystathionine-beta-synthase

Cystathionine beta-synthase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cystathionine beta-synthase cDNA ORF Clone in Cloning Vector, Rat RG82524-U
Cystathionine beta-synthase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82524-ACGLN

Cystathionine beta-synthase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cystathionine beta-synthase cDNA ORF Clone in Cloning Vector, Mouse MG53006-U
Cystathionine beta-synthase cDNA ORF Clone, Mouse, untagged MG53006-UT
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53006-ACG
Cystathionine beta-synthase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53006-ACGLN
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53006-ANG
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53006-ACR
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53006-ANR
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53006-CF
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53006-NF
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-His tag MG53006-CH
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-His tag MG53006-NH
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-HA tag MG53006-CY
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-HA tag MG53006-NY
Cystathionine beta-synthase cDNA ORF Clone, Mouse, C-Myc tag MG53006-CM
Cystathionine beta-synthase cDNA ORF Clone, Mouse, N-Myc tag MG53006-NM

Cystathionine beta-synthase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cystathionine beta-synthase cDNA ORF Clone in Cloning Vector, Human HG14286-G
Cystathionine beta-synthase cDNA ORF Clone, Human, C-GFPSpark® tag HG14286-ACG
Cystathionine beta-synthase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14286-ACGLN
Cystathionine beta-synthase cDNA ORF Clone, Human, N-GFPSpark® tag HG14286-ANG
Cystathionine beta-synthase cDNA ORF Clone, Human, C-OFPSpark® tag HG14286-ACR
Cystathionine beta-synthase cDNA ORF Clone, Human, N-OFPSpark® tag HG14286-ANR
Cystathionine beta-synthase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14286-CF
Cystathionine beta-synthase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14286-NF
Cystathionine beta-synthase cDNA ORF Clone, Human, C-His tag HG14286-CH
Cystathionine beta-synthase cDNA ORF Clone, Human, N-His tag HG14286-NH
Cystathionine beta-synthase cDNA ORF Clone, Human, C-HA tag HG14286-CY
Cystathionine beta-synthase cDNA ORF Clone, Human, N-HA tag HG14286-NY
Cystathionine beta-synthase cDNA ORF Clone, Human, C-Myc tag HG14286-CM
Cystathionine beta-synthase cDNA ORF Clone, Human, N-Myc tag HG14286-NM
Cystathionine beta-synthase qPCR Primer Pairs, Human HP102936
info info
添加购物车成功! 添加购物车失败!