Text Size:AAA

Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human CBR3 cDNA Clone Product Information
    NCBI RefSeq:BC002812
    RefSeq ORF Size:834bp
    cDNA Description:Full length Clone DNA of Homo sapiens carbonyl reductase 3 with N terminal Myc tag.
    Gene Synonym:hCBR3, SDR21C2
    Species:Human
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CBR3 qPCR primers for gene expression analysis, HP103266 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc tag on other vectors
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14632-ACG$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14632-ACR$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14632-ANG$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14632-ANR$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG14632-CF$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His tagHG14632-CH$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG14632-CM$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG14632-CY$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone in cloning vectorHG14632-G$75
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG14632-NF$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-His tagHG14632-NH$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG14632-NM$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG14632-NY$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmidHG14632-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas, intestine, colon, kidney, brain, thymus, lung, heart, liver, spleen, leukocyte, prostate and testis. It is a monomeric NADPH-dependent oxidoreductase and is closely linked to another carbonyl reductase gene – CBR1. CBR3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. It has low NADPH-dependent oxidoreductase activity towards 4-benzoylpyridine and menadione (in vitro).

    References
  • Lakhman SS. et al., 2005. Drug Metab Dispos. 33 (2): 254-7.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Catalog: HG14632-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"