Quick Order

Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human CBR3 cDNA Clone Product Information
    NCBI RefSeq:BC002812
    RefSeq ORF Size:834bp
    cDNA Description:Full length Clone DNA of Homo sapiens carbonyl reductase 3 with N terminal HA tag.
    Gene Synonym:hCBR3, SDR21C2
    Species:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CBR3 qPCR primers for gene expression analysis, HP103266 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14632-ACG$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14632-ACR$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14632-ANG$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14632-ANR$225
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG14632-CF$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His tagHG14632-CH$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG14632-CM$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG14632-CY$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone in cloning vectorHG14632-G$75
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG14632-NF$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-His tagHG14632-NH$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG14632-NM$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG14632-NY$195
    Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmidHG14632-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas, intestine, colon, kidney, brain, thymus, lung, heart, liver, spleen, leukocyte, prostate and testis. It is a monomeric NADPH-dependent oxidoreductase and is closely linked to another carbonyl reductase gene – CBR1. CBR3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. It has low NADPH-dependent oxidoreductase activity towards 4-benzoylpyridine and menadione (in vitro).

    References
  • Lakhman SS. et al., 2005. Drug Metab Dispos. 33 (2): 254-7.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Catalog: HG14632-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"