Quick Order

Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CBR3 cDNA Clone Product Information
NCBI RefSeq:BC002812
RefSeq ORF Size:834bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonyl reductase 3 with C terminal His tag.
Gene Synonym:hCBR3, SDR21C2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14632-ACG$225
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14632-ACR$225
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14632-ANG$225
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14632-ANR$225
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG14632-CF$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-His tagHG14632-CH$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG14632-CM$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG14632-CY$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone in cloning vectorHG14632-G$75
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG14632-NF$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-His tagHG14632-NH$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG14632-NM$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG14632-NY$195
Human CBR3 / HCBR3 / Carbonyl Reductase 3 Gene ORF cDNA clone expression plasmidHG14632-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas, intestine, colon, kidney, brain, thymus, lung, heart, liver, spleen, leukocyte, prostate and testis. It is a monomeric NADPH-dependent oxidoreductase and is closely linked to another carbonyl reductase gene – CBR1. CBR3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. It has low NADPH-dependent oxidoreductase activity towards 4-benzoylpyridine and menadione (in vitro).

References
  • Lakhman SS. et al., 2005. Drug Metab Dispos. 33 (2): 254-7.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Catalog: HG14632-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"