CAV2/Caveolin-2 cDNA ORF Clone, Human, untagged

Cat: HG14521-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CAV2/Caveolin-2 Reagents
CRO Services
Product recommended

All CAV2/Caveolin-2 Reagents
CAV2/Caveolin-2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human caveolin 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+0.49kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CAV2/Caveolin-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAV2/Caveolin-2 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
CAV2/Caveolin-2 cDNA ORF Clone, Human, untagged Alternative Names
CAV cDNA ORF Clone, Human
CAV2/Caveolin-2 Background Information
Full Name
caveolin 2

CAV2/Caveolin-2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAV2/Caveolin-2 cDNA ORF Clone in Cloning Vector, Mouse MG52168-G
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, untagged MG52168-UT
CAV2/Caveolin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52168-ACGLN
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52168-ACG
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52168-ANG
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52168-ACR
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52168-ANR
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52168-CF
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52168-NF
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-His tag MG52168-CH
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-His tag MG52168-NH
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-HA tag MG52168-CY
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-HA tag MG52168-NY
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, C-Myc tag MG52168-CM
CAV2/Caveolin-2 cDNA ORF Clone, Mouse, N-Myc tag MG52168-NM
CAV2/Caveolin-2 qPCR Primer Pairs, Mouse MP202041

CAV2/Caveolin-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAV2/Caveolin-2 cDNA ORF Clone in Cloning Vector, Human HG14521-G
CAV2/Caveolin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14521-ACGLN
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14521-ACG
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14521-ANG
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14521-ACR
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14521-ANR
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14521-CF
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14521-NF
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-His tag HG14521-CH
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-His tag HG14521-NH
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-HA tag HG14521-CY
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-HA tag HG14521-NY
CAV2/Caveolin-2 cDNA ORF Clone, Human, C-Myc tag HG14521-CM
CAV2/Caveolin-2 cDNA ORF Clone, Human, N-Myc tag HG14521-NM
CAV2/Caveolin-2 qPCR Primer Pairs, Human HP103168
info info
添加购物车成功! 添加购物车失败!