Quick Order

Human CAT/Catalase Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CAT cDNA Clone Product Information
    NCBI RefSeq:NM_001752.3
    RefSeq ORF Size:1584bp
    cDNA Description:Full length Clone DNA of Homo sapiens catalase with C terminal His tag.
    Gene Synonym:MGC138422, MGC138424, CAT
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAT qPCR primers for gene expression analysis, HP101612 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

    References
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Catalog: HG12084-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"