After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Calsequestrin-1 / CASQ1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CASQ1 cDNA Clone Product Information
NCBI RefSeq:BC022289
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Homo sapiens calsequestrin 1 (fast-twitch, skeletal muscle) with N terminal His tag.
Gene Synonym:CASQ, PDIB1, CASQ1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium in the cisterna of the sarcoplasmic reticulum after a muscle contraction, even though the concentration of calcium in the sarcoplasmic reticulum is much higher than in the cytosol. Two forms of calsequestrin have been identified: Calsequestrin-2 and Calsequestrin-1. Calsequestrin-1 is found in fast skeletal muscle. The release of calsequestrin-bound calcium (through a calcium release channel) triggers muscle contraction. The active protein is not highly structured, more than 50% of it adopting a random coil conformation. When calcium binds there is a structural change whereby the alpha-helical content of the protein increases from 3 to 11%. Both forms of calsequestrin are phosphorylated by casein kinase 2, but the cardiac form is phosphorylated more rapidly and to a higher degree. Calsequestrin-1 is also secreted in the gut where it deprives bacteria of calcium ions.

References
  • Slupsky JR, et al. (1987) Characterization of cardiac calsequestrin. Biochemistry. 26(20): 6539-44.
  • Cala SE, et al. (1991) Phosphorylation of cardiac and skeletal muscle calsequestrin isoforms by casein kinase II. Demonstration of a cluster of unique rapidly phosphorylated sites in cardiac calsequestrin. J Biol Chem. 266(1):391-8.
  • Wang S, et al. (1998) Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol. 5(6):476-83.
  • Size / Price
    Catalog: HG13805-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"