Quick Order

Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CASP1 cDNA Clone Product Information
    NCBI RefSeq:NM_033292.2
    RefSeq ORF Size:1215bp
    cDNA Description:Full length Clone DNA of Homo sapiens caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase), transcript variant alpha with C terminal His tag.
    Gene Synonym:ICE, P45, IL1BC, CASP1
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CASP1 qPCR primers for gene expression analysis, HP101057 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11148-ACG$225
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11148-ACR$225
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11148-ANG$225
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11148-ANR$225
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG11148-CF$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tagHG11148-CH$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Myc tagHG11148-CM$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-HA tagHG11148-CY$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG11148-M$75
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG11148-M-F$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Flag tagHG11148-NF$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tagHG11148-NH$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Myc tagHG11148-NM$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-HA tagHG11148-NY$195
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG11148-U$75
    Human Caspase-1/CASP1 transcript variant alpha Gene ORF cDNA clone expression plasmidHG11148-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: HG11148-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"