CARHSP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14333-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CARHSP1 Reagents
CRO Services
Product recommended

All CARHSP1 Reagents
CARHSP1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human calcium regulated heat stable protein 1, 24kDa with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CARHSP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CRHSP-24 cDNA ORF Clone, Human;CSDC1 cDNA ORF Clone, Human
CARHSP1 Background Information

CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize the role of CARHSP1 in the regulation of gluconeogenic gene expression. CARHSP1 is regulated by nutrient status in the liver and functions at the transcriptional level to negatively regulate gluconeogenic genes, including the glucose-6-phosphatase catalytic subunit (G6Pc) and phosphoenolpyruvate carboxykinase 1 (PEPCK1). In addition, it is found that CARHSP1 can physically interact with peroxisome proliferator-activated receptor-α (PPARα) and inhibit its transcriptional activity. Both pharmacological and genetic ablations of PPARα attenuate the inhibitory effect of CARHSP1 on gluconeogenic gene expression in hepatocytes.

Full Name
calcium regulated heat stable protein 1, 24kDa
References
  • Wistow G. et al., 2002, Mol Vis. 8: 205-20.
  • Wishart MJ. et al., 2002, Proc Natl Acad Sci. 99 (4): 2112-7.
  • Groblewski GE. et al., 1998, J Biol Chem. 273 (35): 22738-44.
  • Fan Y. et al., 2011, J Biol Chem. 286 (47): 40584-94.
  • CARHSP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CARHSP1 cDNA ORF Clone in Cloning Vector, Mouse MG5A2503-U
    CARHSP1 cDNA ORF Clone, Mouse, untagged MG5A2503-UT
    CARHSP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2503-ACG
    CARHSP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2503-ACGLN
    CARHSP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2503-ANG
    CARHSP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2503-ACR
    CARHSP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2503-ANR
    CARHSP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2503-CF
    CARHSP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2503-NF
    CARHSP1 cDNA ORF Clone, Mouse, C-His tag MG5A2503-CH
    CARHSP1 cDNA ORF Clone, Mouse, N-His tag MG5A2503-NH
    CARHSP1 cDNA ORF Clone, Mouse, C-HA tag MG5A2503-CY
    CARHSP1 cDNA ORF Clone, Mouse, N-HA tag MG5A2503-NY
    CARHSP1 cDNA ORF Clone, Mouse, C-Myc tag MG5A2503-CM
    CARHSP1 cDNA ORF Clone, Mouse, N-Myc tag MG5A2503-NM

    CARHSP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CARHSP1 cDNA ORF Clone in Cloning Vector, Human HG14333-G
    CARHSP1 cDNA ORF Clone, Human, untagged HG14333-UT
    CARHSP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14333-ACGLN
    CARHSP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14333-ACG
    CARHSP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14333-ANG
    CARHSP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14333-ACR
    CARHSP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14333-ANR
    CARHSP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14333-CF
    CARHSP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14333-NF
    CARHSP1 cDNA ORF Clone, Human, C-His tag HG14333-CH
    CARHSP1 cDNA ORF Clone, Human, N-His tag HG14333-NH
    CARHSP1 cDNA ORF Clone, Human, C-HA tag HG14333-CY
    CARHSP1 cDNA ORF Clone, Human, N-HA tag HG14333-NY
    CARHSP1 cDNA ORF Clone, Human, C-Myc tag HG14333-CM
    CARHSP1 qPCR Primer Pairs, Human HP102983
    info info
    添加购物车成功! 添加购物车失败!