Quick Order

Text Size:AAA

Human CARHSP1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CARHSP1 cDNA Clone Product Information
NCBI RefSeq:BC003366
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium regulated heat stable protein 1, 24kDa.
Gene Synonym:CRHSP-24, CSDC1, MGC111446, CARHSP1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize the role of CARHSP1 in the regulation of gluconeogenic gene expression. CARHSP1 is regulated by nutrient status in the liver and functions at the transcriptional level to negatively regulate gluconeogenic genes, including the glucose-6-phosphatase catalytic subunit (G6Pc) and phosphoenolpyruvate carboxykinase 1 (PEPCK1). In addition, it is found that CARHSP1 can physically interact with peroxisome proliferator-activated receptor-α (PPARα) and inhibit its transcriptional activity. Both pharmacological and genetic ablations of PPARα attenuate the inhibitory effect of CARHSP1 on gluconeogenic gene expression in hepatocytes.

References
  • Wistow G. et al., 2002, Mol Vis. 8: 205-20.
  • Wishart MJ. et al., 2002, Proc Natl Acad Sci. 99 (4): 2112-7.
  • Groblewski GE. et al., 1998, J Biol Chem. 273 (35): 22738-44.
  • Fan Y. et al., 2011, J Biol Chem. 286 (47): 40584-94.
  • Size / Price
    Catalog: HG14333-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"