After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CARHSP1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CARHSP1 cDNA Clone Product Information
NCBI RefSeq:BC003366
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium regulated heat stable protein 1, 24kDa with N terminal Myc tag.
Gene Synonym:CRHSP-24, CSDC1, MGC111446, CARHSP1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize the role of CARHSP1 in the regulation of gluconeogenic gene expression. CARHSP1 is regulated by nutrient status in the liver and functions at the transcriptional level to negatively regulate gluconeogenic genes, including the glucose-6-phosphatase catalytic subunit (G6Pc) and phosphoenolpyruvate carboxykinase 1 (PEPCK1). In addition, it is found that CARHSP1 can physically interact with peroxisome proliferator-activated receptor-α (PPARα) and inhibit its transcriptional activity. Both pharmacological and genetic ablations of PPARα attenuate the inhibitory effect of CARHSP1 on gluconeogenic gene expression in hepatocytes.

References
  • Wistow G. et al., 2002, Mol Vis. 8: 205-20.
  • Wishart MJ. et al., 2002, Proc Natl Acad Sci. 99 (4): 2112-7.
  • Groblewski GE. et al., 1998, J Biol Chem. 273 (35): 22738-44.
  • Fan Y. et al., 2011, J Biol Chem. 286 (47): 40584-94.
  • Size / Price
    Catalog: HG14333-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"