CAPG cDNA ORF Clone, Human, untagged

Cat: HG14213-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CAPG Reagents
CRO Services
Product recommended

All CAPG Reagents
CAPG cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Human capping protein (actin filament), gelsolin-like.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAPG cDNA ORF Clone, Human, untagged Alternative Names
AFCP cDNA ORF Clone, Human;HEL-S-66 cDNA ORF Clone, Human;MCP cDNA ORF Clone, Human
CAPG Background Information

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

Full Name
capping protein (actin filament), gelsolin-like
References
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • CAPG cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CAPG cDNA ORF Clone in Cloning Vector, Rat RG8A0088-U
    CAPG Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0088-ACGLN

    CAPG cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CAPG cDNA ORF Clone in Cloning Vector, Mouse MG53848-U
    CAPG cDNA ORF Clone, Mouse, untagged MG53848-UT
    CAPG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53848-ACGLN
    CAPG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53848-ACG
    CAPG cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53848-ANG
    CAPG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53848-ACR
    CAPG cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53848-ANR
    CAPG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53848-CF
    CAPG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53848-NF
    CAPG cDNA ORF Clone, Mouse, C-His tag MG53848-CH
    CAPG cDNA ORF Clone, Mouse, N-His tag MG53848-NH
    CAPG cDNA ORF Clone, Mouse, C-HA tag MG53848-CY
    CAPG cDNA ORF Clone, Mouse, N-HA tag MG53848-NY
    CAPG cDNA ORF Clone, Mouse, C-Myc tag MG53848-CM
    CAPG cDNA ORF Clone, Mouse, N-Myc tag MG53848-NM

    CAPG cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CAPG cDNA ORF Clone in Cloning Vector, Human HG14213-G
    CAPG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14213-ACGLN
    CAPG cDNA ORF Clone, Human, C-GFPSpark® tag HG14213-ACG
    CAPG cDNA ORF Clone, Human, N-GFPSpark® tag HG14213-ANG
    CAPG cDNA ORF Clone, Human, C-OFPSpark® tag HG14213-ACR
    CAPG cDNA ORF Clone, Human, N-OFPSpark® tag HG14213-ANR
    CAPG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14213-CF
    CAPG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14213-NF
    CAPG cDNA ORF Clone, Human, C-His tag HG14213-CH
    CAPG cDNA ORF Clone, Human, N-His tag HG14213-NH
    CAPG cDNA ORF Clone, Human, C-HA tag HG14213-CY
    CAPG cDNA ORF Clone, Human, N-HA tag HG14213-NY
    CAPG cDNA ORF Clone, Human, C-Myc tag HG14213-CM
    CAPG cDNA ORF Clone, Human, N-Myc tag HG14213-NM
    CAPG qPCR Primer Pairs, Human HP102863
    info info
    添加购物车成功! 添加购物车失败!