CAP1 cDNA ORF Clone, Human, untagged

Cat: HG16251-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CAP1 Reagents
CRO Services
Product recommended

All CAP1 Reagents
CAP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Human CAP, adenylate cyclase-associated protein 1 (yeast).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAP1 cDNA ORF Clone, Human, untagged Alternative Names
CAP cDNA ORF Clone, Human;CAP1-PEN cDNA ORF Clone, Human
CAP1 Background Information
Full Name
CAP, adenylate cyclase-associated protein 1 (yeast)

CAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CAP1 cDNA ORF Clone in Cloning Vector, Rat RG84892-U
CAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84892-ACGLN

CAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52802-G
CAP1 cDNA ORF Clone, Mouse, untagged MG52802-UT
CAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52802-ACGLN
CAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52802-ACG
CAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52802-ANG
CAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52802-ACR
CAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52802-ANR
CAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52802-CF
CAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52802-NF
CAP1 cDNA ORF Clone, Mouse, C-His tag MG52802-CH
CAP1 cDNA ORF Clone, Mouse, N-His tag MG52802-NH
CAP1 cDNA ORF Clone, Mouse, C-HA tag MG52802-CY
CAP1 cDNA ORF Clone, Mouse, N-HA tag MG52802-NY
CAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52802-CM
CAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52802-NM

CAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAP1 cDNA ORF Clone in Cloning Vector, Human HG16251-G
CAP1 cDNA ORF Clone, Human, untagged HG12527-UT
CAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12527-ACGLN
CAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16251-ACG
CAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16251-ACGLN
CAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16251-ACR
CAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16251-CF
CAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16251-NF
CAP1 cDNA ORF Clone, Human, C-His tag HG16251-CH
CAP1 cDNA ORF Clone, Human, N-His tag HG16251-NH
CAP1 cDNA ORF Clone, Human, C-HA tag HG16251-CY
CAP1 cDNA ORF Clone, Human, N-HA tag HG16251-NY
CAP1 cDNA ORF Clone, Human, C-Myc tag HG16251-CM
CAP1 cDNA ORF Clone, Human, N-Myc tag HG16251-NM
CAP1 qPCR Primer Pairs, Human HP104841
info info
添加购物车成功! 添加购物车失败!