CAMKV cDNA ORF Clone, Human, C-Myc tag

Cat: HG12243-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CAMKV Reagents
CRO Services
Product recommended

All CAMKV Reagents
CAMKV cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Description
Full length Clone DNA of Human CaM kinase-like vesicle-associated with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAMKV cDNA ORF Clone, Human, C-Myc tag Alternative Names
1G5 cDNA ORF Clone, Human;VACAMKL cDNA ORF Clone, Human
CAMKV Background Information

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

Full Name
CaM kinase-like vesicle-associated
References
  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • CAMKV cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CAMKV cDNA ORF Clone in Cloning Vector, Mouse MG52245-G
    CAMKV cDNA ORF Clone, Mouse, untagged MG52245-UT
    CAMKV Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52245-ACGLN
    CAMKV cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52245-ACG
    CAMKV cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52245-ANG
    CAMKV cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52245-ACR
    CAMKV cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52245-ANR
    CAMKV cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52245-CF
    CAMKV cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52245-NF
    CAMKV cDNA ORF Clone, Mouse, C-His tag MG52245-CH
    CAMKV cDNA ORF Clone, Mouse, N-His tag MG52245-NH
    CAMKV cDNA ORF Clone, Mouse, C-HA tag MG52245-CY
    CAMKV cDNA ORF Clone, Mouse, N-HA tag MG52245-NY
    CAMKV cDNA ORF Clone, Mouse, C-Myc tag MG52245-CM
    CAMKV cDNA ORF Clone, Mouse, N-Myc tag MG52245-NM
    CAMKV qPCR Primer Pairs, Mouse MP202118

    CAMKV cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CAMKV cDNA ORF Clone in Cloning Vector, Human HG12243-G
    CAMKV cDNA ORF Clone, Human, untagged HG12243-UT
    CAMKV cDNA ORF Clone, Human, C-GFPSpark® tag HG12243-ACG
    CAMKV Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12243-ACGLN
    CAMKV cDNA ORF Clone, Human, N-GFPSpark® tag HG12243-ANG
    CAMKV cDNA ORF Clone, Human, C-OFPSpark® tag HG12243-ACR
    CAMKV cDNA ORF Clone, Human, N-OFPSpark® tag HG12243-ANR
    CAMKV cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12243-CF
    CAMKV cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12243-NF
    CAMKV cDNA ORF Clone, Human, C-His tag HG12243-CH
    CAMKV cDNA ORF Clone, Human, N-His tag HG12243-NH
    CAMKV cDNA ORF Clone, Human, C-HA tag HG12243-CY
    CAMKV cDNA ORF Clone, Human, N-HA tag HG12243-NY
    CAMKV cDNA ORF Clone, Human, N-Myc tag HG12243-NM
    CAMKV qPCR Primer Pairs, Human HP101901
    info info
    添加购物车成功! 添加购物车失败!