Quick Order

Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CAMK2G cDNA Clone Product Information
    NCBI RefSeq:NM_172170.3
    RefSeq ORF Size:1557bp
    cDNA Description:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal His tag.
    Gene Synonym:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAMK2G qPCR primers for gene expression analysis, HP101037 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11125-ACG$245
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11125-ACR$245
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11125-ANG$245
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11125-ANR$245
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11125-CF$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG11125-CH$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11125-CM$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG11125-CY$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone in cloning vectorHG11125-M$75
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11125-M-F$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11125-NF$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG11125-NH$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11125-NM$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG11125-NY$215
    Human CaMKII/CAMK2G transcript variant 3 Gene ORF cDNA clone expression plasmidHG11125-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: HG11125-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"