CAMK1D cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10728-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CAMK1D Reagents
CRO Services
Product recommended

All CAMK1D Reagents
CAMK1D cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1158 bp
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase ID with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAMK1D cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human CAMK1D/CKLiK Gene Expression validated Image 16574
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CAMK1D cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CaM-K1 cDNA ORF Clone, Human;CaMKID cDNA ORF Clone, Human;CKLiK cDNA ORF Clone, Human
CAMK1D Background Information

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

Full Name
calcium/calmodulin-dependent protein kinase ID
References
  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
  • info info
    添加购物车成功! 添加购物车失败!