Calumenin cDNA ORF Clone, Human, C-His tag

Cat: HG13486-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Calumenin Reagents
CRO Services
Product recommended

All Calumenin Reagents
Calumenin cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
948 bp
Description
Full length Clone DNA of Human calumenin with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Calumenin Background Information

Calumenin belongs to the CREC family. It contains 6 EF-hand domains. Calumenin is expressed in skeletal muscle (at protein level). Calumenin interacts with GGCX and RYR1 in the presence of calcium ions, but not in the presence of EDTA. Calumenin is Involved in regulation of vitamin K-dependent carboxylation of multiple N-terminal glutamate residues. It seems to inhibit gamma-carboxylase GGCX. Calumenin also binds 7 calcium ions with a low affinity and may modulate calcium release from the sarcoplasmic reticulum.

Full Name
calumenin
References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Vorum H, et al. (2000) Calumenin interacts with serum amyloid P component. FEBS Lett. 465 (2-3):129-34.
  • Vorum H, et al. (1999) n calumenin localizes to the secretory pathway and is secreted to the medium. Exp Cell Res. 248(2):473-81.
  • Calumenin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Calumenin cDNA ORF Clone in Cloning Vector, Mouse MG5A1220-U
    Calumenin cDNA ORF Clone, Mouse, untagged MG5A1220-UT
    Calumenin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1220-ACGLN
    Calumenin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1220-ACG
    Calumenin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1220-ACR
    Calumenin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1220-CF
    Calumenin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1220-NF
    Calumenin cDNA ORF Clone, Mouse, C-His tag MG5A1220-CH
    Calumenin cDNA ORF Clone, Mouse, N-His tag MG5A1220-NH
    Calumenin cDNA ORF Clone, Mouse, C-HA tag MG5A1220-CY
    Calumenin cDNA ORF Clone, Mouse, N-HA tag MG5A1220-NY
    Calumenin cDNA ORF Clone, Mouse, C-Myc tag MG5A1220-CM
    Calumenin cDNA ORF Clone, Mouse, N-Myc tag MG5A1220-NM

    Calumenin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Calumenin cDNA ORF Clone in Cloning Vector, Human HG13486-G
    Calumenin cDNA ORF Clone, Human, untagged HG13486-UT
    Calumenin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13486-ACGLN
    Calumenin cDNA ORF Clone, Human, C-GFPSpark® tag HG13486-ACG
    Calumenin cDNA ORF Clone, Human, C-OFPSpark® tag HG13486-ACR
    Calumenin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13486-CF
    Calumenin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13486-NF
    Calumenin cDNA ORF Clone, Human, N-His tag HG13486-NH
    Calumenin cDNA ORF Clone, Human, C-HA tag HG13486-CY
    Calumenin cDNA ORF Clone, Human, N-HA tag HG13486-NY
    Calumenin cDNA ORF Clone, Human, C-Myc tag HG13486-CM
    Calumenin cDNA ORF Clone, Human, N-Myc tag HG13486-NM
    Calumenin qPCR Primer Pairs, Human HP102186
    info info
    添加购物车成功! 添加购物车失败!