Quick Order

Text Size:AAA

Human Calumenin Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CALU cDNA Clone Product Information
NCBI RefSeq:BC013383
RefSeq ORF Size:948bp
cDNA Description:Full length Clone DNA of Homo sapiens calumenin with C terminal His tag.
Gene Synonym:CALU
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Calumenin belongs to the CREC family. It contains 6 EF-hand domains. Calumenin is expressed in skeletal muscle (at protein level). Calumenin interacts with GGCX and RYR1 in the presence of calcium ions, but not in the presence of EDTA. Calumenin is Involved in regulation of vitamin K-dependent carboxylation of multiple N-terminal glutamate residues. It seems to inhibit gamma-carboxylase GGCX. Calumenin also binds 7 calcium ions with a low affinity and may modulate calcium release from the sarcoplasmic reticulum.

References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Vorum H, et al. (2000) Calumenin interacts with serum amyloid P component. FEBS Lett. 465 (2-3):129-34.
  • Vorum H, et al. (1999) n calumenin localizes to the secretory pathway and is secreted to the medium. Exp Cell Res. 248(2):473-81.
  • Size / Price
    Catalog: HG13486-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"