Calmodulin 1/CALM1 cDNA ORF Clone, Human, untagged

Cat: HG16252-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Calmodulin 1/CALM1 Reagents
CRO Services
Product recommended

All Calmodulin 1/CALM1 Reagents
Calmodulin 1/CALM1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Human calmodulin 1 (phosphorylase kinase, delta).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Calmodulin 1/CALM1 cDNA ORF Clone, Human, untagged Alternative Names
CALML2 cDNA ORF Clone, Human;caM cDNA ORF Clone, Human;CAMI cDNA ORF Clone, Human;CPVT4 cDNA ORF Clone, Human;DD132 cDNA ORF Clone, Human;LQT14 cDNA ORF Clone, Human;PHKD cDNA ORF Clone, Human
Calmodulin 1/CALM1 Background Information
Full Name
calmodulin 1 (phosphorylase kinase, delta)

Calmodulin 1/CALM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Calmodulin 1/CALM1 cDNA ORF Clone in Cloning Vector, Rat RG80861-G
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, untagged RG80861-UT
Calmodulin 1/CALM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80861-ACGLN
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80861-ACG
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80861-ANG
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80861-ACR
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80861-ANR
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80861-CF
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80861-NF
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-His tag RG80861-CH
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-His tag RG80861-NH
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-HA tag RG80861-CY
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-HA tag RG80861-NY
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, C-Myc tag RG80861-CM
Calmodulin 1/CALM1 cDNA ORF Clone, Rat, N-Myc tag RG80861-NM
Calmodulin 1/CALM1 qPCR Primer Pairs, Rat RP300825

Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Calmodulin 1/CALM1 cDNA ORF Clone in Cloning Vector, Mouse MG53608-U
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, untagged MG53608-UT
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53608-ACG
Calmodulin 1/CALM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53608-ACGLN
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53608-ANG
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53608-ACR
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53608-ANR
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53608-CF
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53608-NF
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-His tag MG53608-CH
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-His tag MG53608-NH
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-HA tag MG53608-CY
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-HA tag MG53608-NY
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, C-Myc tag MG53608-CM
Calmodulin 1/CALM1 cDNA ORF Clone, Mouse, N-Myc tag MG53608-NM

Calmodulin 1/CALM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Calmodulin 1/CALM1 cDNA ORF Clone in Cloning Vector, Human HG16252-G
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16252-ACG
Calmodulin 1/CALM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16252-ACGLN
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16252-ANG
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16252-ACR
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16252-ANR
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16252-CF
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16252-NF
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-His tag HG16252-CH
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-His tag HG16252-NH
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-HA tag HG16252-CY
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-HA tag HG16252-NY
Calmodulin 1/CALM1 cDNA ORF Clone, Human, C-Myc tag HG16252-CM
Calmodulin 1/CALM1 cDNA ORF Clone, Human, N-Myc tag HG16252-NM
Calmodulin 1/CALM1 qPCR Primer Pairs, Human HP105015
info info
添加购物车成功! 添加购物车失败!