CADM3 cDNA ORF Clone, Human, untagged

Cat: HG11214-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CADM3 Reagents
CRO Services
Product recommended

All CADM3 Reagents
CADM3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Description
Full length Clone DNA of Human cell adhesion molecule 3, transcript variant 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CADM3 cDNA ORF Clone, Human, untagged Alternative Names
BIgR cDNA ORF Clone, Human;IGSF4B cDNA ORF Clone, Human;Necl-1 cDNA ORF Clone, Human;NECL1 cDNA ORF Clone, Human;synCAM3 cDNA ORF Clone, Human;TSLL1 cDNA ORF Clone, Human
CADM3 Background Information

Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either with other CAMs of the same kind (homophilic binding) or with other CAMs or the extracellular matrix (heterophilic binding). Cell adhesion molecule 3, also known as Immunoglobulin superfamily member 4B, CADM3, and NECL1, is a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule which has Ca(2+)-independent homo- or heterophilic cell-cell adhesion activity and plays an important role in the formation of synapses, axon bundles and myelinated axons. Isoform 1 of CADM3 is expressed mainly in adult and fetal brain. Isoform 2 of CADM3 is highly expressed in adult brain and weakly expressed in placenta. In brain, Isoform 2 is highly expressed in cerebellum. CADM3 is involved in the cell-cell adhesion. It has both calcium-independent homophilic cell-cell adhesion activity and calcium-independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. The interaction with EPB41L1 may regulate structure or function of cell-cell junctions. CADM3 may act as a tumor suppressor in glioma and loss of it in glioma may be caused by histone deacetylation.

Full Name
cell adhesion molecule 3
References
  • Dong X, et al. (2006) Crystal structure of the V domain of human Nectin-like molecule-1/Syncam3/Tsll1/Igsf4b, a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule. J Biol Chem. 281(15): 10610-7.
  • Gao J, et al. (2008) Nectin-like molecule 1 is a glycoprotein with a single N-glycosylation site at N290KS which influences its adhesion activity. Biochim Biophys Acta. 1778(6): 1429-35.
  • Gao J, et al. (2009) Loss of NECL1, a novel tumor suppressor, can be restored in glioma by HDAC inhibitor-Trichostatin A through Sp1 binding site. Glia. 57(9): 989-99.
  • CADM3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CADM3 cDNA ORF Clone in Cloning Vector, Rat RG80220-G
    CADM3 cDNA ORF Clone, Rat, untagged RG80220-UT
    CADM3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80220-ACGLN
    CADM3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80220-ACG
    CADM3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80220-ACR
    CADM3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80220-CF
    CADM3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80220-NF
    CADM3 cDNA ORF Clone, Rat, C-His tag RG80220-CH
    CADM3 cDNA ORF Clone, Rat, N-His tag RG80220-NH
    CADM3 cDNA ORF Clone, Rat, C-HA tag RG80220-CY
    CADM3 cDNA ORF Clone, Rat, N-HA tag RG80220-NY
    CADM3 cDNA ORF Clone, Rat, C-Myc tag RG80220-CM
    CADM3 cDNA ORF Clone, Rat, N-Myc tag RG80220-NM
    CADM3 qPCR Primer Pairs, Rat RP300211

    CADM3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CADM3 cDNA ORF Clone in Cloning Vector, Mouse MG50476-M
    CADM3 cDNA ORF Clone, Mouse, untagged MG50476-UT
    CADM3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50476-ACG
    CADM3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50476-ACGLN
    CADM3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50476-ACR
    CADM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50476-CF
    CADM3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50476-NF
    CADM3 cDNA ORF Clone, Mouse, C-His tag MG50476-CH
    CADM3 cDNA ORF Clone, Mouse, N-His tag MG50476-NH
    CADM3 cDNA ORF Clone, Mouse, C-HA tag MG50476-CY
    CADM3 cDNA ORF Clone, Mouse, N-HA tag MG50476-NY
    CADM3 cDNA ORF Clone, Mouse, C-Myc tag MG50476-CM
    CADM3 cDNA ORF Clone, Mouse, N-Myc tag MG50476-NM
    CADM3 qPCR Primer Pairs, Mouse MP200095

    CADM3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CADM3 cDNA ORF Clone in Cloning Vector, Human HG11214-M
    CADM3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11214-ACGLN
    CADM3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11214-ACG
    CADM3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11214-ACR
    CADM3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11214-CF
    CADM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11214-NF
    CADM3 cDNA ORF Clone, Human, C-His tag HG11214-CH
    CADM3 cDNA ORF Clone, Human, N-His tag HG11214-NH
    CADM3 cDNA ORF Clone, Human, C-HA tag HG11214-CY
    CADM3 cDNA ORF Clone, Human, N-HA tag HG11214-NY
    CADM3 cDNA ORF Clone, Human, C-Myc tag HG11214-CM
    CADM3 cDNA ORF Clone, Human, N-Myc tag HG11214-NM
    CADM3 qPCR Primer Pairs, Human HP101116
    info info
    添加购物车成功! 添加购物车失败!