CACNLG/CACNG1 cDNA ORF Clone, Human, C-HA tag

Cat: HG15864-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CACNLG/CACNG1 Reagents
CRO Services
Product recommended

All CACNLG/CACNG1 Reagents
CACNLG/CACNG1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Human calcium channel, voltage-dependent, gamma subunit 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CACNLG/CACNG1 cDNA ORF Clone, Human, C-HA tag Alternative Names
CACNLG cDNA ORF Clone, Human
CACNLG/CACNG1 Background Information
Full Name
calcium channel, voltage-dependent, gamma subunit 1

CACNLG/CACNG1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CACNLG/CACNG1 cDNA ORF Clone in Cloning Vector, Rat RG81259-U
CACNLG/CACNG1 cDNA ORF Clone, Rat, untagged RG81259-UT
CACNLG/CACNG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81259-ACGLN
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81259-ACG
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81259-ACR
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81259-CF
CACNLG/CACNG1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81259-NF
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-His tag RG81259-CH
CACNLG/CACNG1 cDNA ORF Clone, Rat, N-His tag RG81259-NH
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-HA tag RG81259-CY
CACNLG/CACNG1 cDNA ORF Clone, Rat, N-HA tag RG81259-NY
CACNLG/CACNG1 cDNA ORF Clone, Rat, C-Myc tag RG81259-CM
CACNLG/CACNG1 cDNA ORF Clone, Rat, N-Myc tag RG81259-NM
CACNLG/CACNG1 qPCR Primer Pairs, Rat RP301215

CACNLG/CACNG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CACNLG/CACNG1 cDNA ORF Clone in Cloning Vector, Human HG15864-G
CACNLG/CACNG1 cDNA ORF Clone, Human, untagged HG15864-UT
CACNLG/CACNG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15864-ACGLN
CACNLG/CACNG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15864-ACG
CACNLG/CACNG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15864-ANG
CACNLG/CACNG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15864-ACR
CACNLG/CACNG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15864-ANR
CACNLG/CACNG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15864-CF
CACNLG/CACNG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15864-NF
CACNLG/CACNG1 cDNA ORF Clone, Human, C-His tag HG15864-CH
CACNLG/CACNG1 cDNA ORF Clone, Human, N-His tag HG15864-NH
CACNLG/CACNG1 cDNA ORF Clone, Human, N-HA tag HG15864-NY
CACNLG/CACNG1 cDNA ORF Clone, Human, C-Myc tag HG15864-CM
CACNLG/CACNG1 cDNA ORF Clone, Human, N-Myc tag HG15864-NM
CACNLG/CACNG1 qPCR Primer Pairs, Human HP104454
info info
添加购物车成功! 添加购物车失败!