CABYR cDNA ORF Clone, Human, untagged

Cat: HG16265-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CABYR Reagents
CRO Services
Product recommended

All CABYR Reagents
CABYR cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Human calcium binding tyrosine-(Y)-phosphorylation regulated
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CABYR cDNA ORF Clone, Human, untagged Alternative Names
CABYRa cDNA ORF Clone, Human;CABYRc cDNA ORF Clone, Human;CABYRc/d cDNA ORF Clone, Human;CABYRe cDNA ORF Clone, Human;CBP86 cDNA ORF Clone, Human;CT88 cDNA ORF Clone, Human;FSP-2 cDNA ORF Clone, Human;FSP2 cDNA ORF Clone, Human
CABYR Background Information
Full Name
calcium binding tyrosine-(Y)-phosphorylation regulated

CABYR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CABYR cDNA ORF Clone in Cloning Vector, Human HG29617-G
CABYR cDNA ORF Clone in Cloning Vector, Human HG16265-G
CABYR cDNA ORF Clone, Human, untagged HG29617-UT
CABYR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29617-ACGLN
CABYR cDNA ORF Clone, Human, C-GFPSpark® tag HG16265-ACG
CABYR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16265-ACGLN
CABYR cDNA ORF Clone, Human, C-GFPSpark® tag HG29617-ACG
CABYR cDNA ORF Clone, Human, N-GFPSpark® tag HG16265-ANG
CABYR cDNA ORF Clone, Human, N-GFPSpark® tag HG29617-ANG
CABYR cDNA ORF Clone, Human, C-OFPSpark® tag HG29617-ACR
CABYR cDNA ORF Clone, Human, C-OFPSpark® tag HG16265-ACR
CABYR cDNA ORF Clone, Human, N-OFPSpark® tag HG16265-ANR
CABYR cDNA ORF Clone, Human, N-OFPSpark® tag HG29617-ANR
CABYR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29617-CF
CABYR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16265-CF
CABYR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16265-NF
CABYR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29617-NF
CABYR cDNA ORF Clone, Human, C-His tag HG29617-CH
CABYR cDNA ORF Clone, Human, C-His tag HG16265-CH
CABYR cDNA ORF Clone, Human, N-His tag HG16265-NH
CABYR cDNA ORF Clone, Human, N-His tag HG29617-NH
CABYR cDNA ORF Clone, Human, C-HA tag HG29617-CY
CABYR cDNA ORF Clone, Human, C-HA tag HG16265-CY
CABYR cDNA ORF Clone, Human, N-HA tag HG29617-NY
CABYR cDNA ORF Clone, Human, N-HA tag HG16265-NY
CABYR cDNA ORF Clone, Human, C-Myc tag HG29617-CM
CABYR cDNA ORF Clone, Human, C-Myc tag HG16265-CM
CABYR cDNA ORF Clone, Human, N-Myc tag HG29617-NM
CABYR cDNA ORF Clone, Human, N-Myc tag HG16265-NM
CABYR qPCR Primer Pairs, Human HP105028
info info
添加购物车成功! 添加购物车失败!