CABP5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13896-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CABP5 Reagents
CRO Services
Product recommended

All CABP5 Reagents
CABP5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
522 bp
Description
Full length Clone DNA of Human calcium binding protein 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CABP5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CABP3 cDNA ORF Clone, Human
CABP5 Background Information

CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of CABP3 gene is retina-specific. The mouse homolog of CABP3 has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of CABP3 gene is unknown. Study of the transcripts and genomic structure revealed that the 5 end of this gene is complementary and reverse to that of the CABP5 gene, and the sequence beyond the overlapping region is nearly identical to that of CABP5. Thus, these two genes encode the protein products with distinct N-terminal halves but identical C-terminal halves. CABP3 inhibits calcium-dependent inactivation of L-type calcium channel and shifts voltage dependence of activation to more depolarized membrane potentials. It is also involved in the transmission of light signals.

Full Name
calcium binding protein 5
References
  • McCauliffe DP, et al. (1990) A human Ro/SS-A autoantigen is the homologue of calreticulin and is highly homologous with onchocercal RAL-1 antigen and an aplysia memory molecule. J Clin Invest. 86(1):332-5.
  • Beutler E, et al. (1997) HLA-H and associated proteins in patients with hemochromatosis. Mol Med. 3(6):397-402.
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • info info
    添加购物车成功! 添加购物车失败!