After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CABP3/CABP5 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CABP5 cDNA Clone Product Information
NCBI RefSeq:BC126133
RefSeq ORF Size:522bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium binding protein 5 with N terminal Myc tag.
Gene Synonym:CABP3, CABP5
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of CABP3 gene is retina-specific. The mouse homolog of CABP3 has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of CABP3 gene is unknown. Study of the transcripts and genomic structure revealed that the 5 end of this gene is complementary and reverse to that of the CABP5 gene, and the sequence beyond the overlapping region is nearly identical to that of CABP5. Thus, these two genes encode the protein products with distinct N-terminal halves but identical C-terminal halves. CABP3 inhibits calcium-dependent inactivation of L-type calcium channel and shifts voltage dependence of activation to more depolarized membrane potentials. It is also involved in the transmission of light signals.

References
  • McCauliffe DP, et al. (1990) A human Ro/SS-A autoantigen is the homologue of calreticulin and is highly homologous with onchocercal RAL-1 antigen and an aplysia memory molecule. J Clin Invest. 86(1):332-5.
  • Beutler E, et al. (1997) HLA-H and associated proteins in patients with hemochromatosis. Mol Med. 3(6):397-402.
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Size / Price
    Catalog: HG13896-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"