Text Size:AAA

Human CABP3/CABP5 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human CABP5 cDNA Clone Product Information
    NCBI RefSeq:BC126133
    RefSeq ORF Size:522bp
    cDNA Description:Full length Clone DNA of Homo sapiens calcium binding protein 5 with N terminal HA tag.
    Gene Synonym:CABP3, CABP5
    Species:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CABP5 qPCR primers for gene expression analysis, HP102561 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of CABP3 gene is retina-specific. The mouse homolog of CABP3 has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of CABP3 gene is unknown. Study of the transcripts and genomic structure revealed that the 5 end of this gene is complementary and reverse to that of the CABP5 gene, and the sequence beyond the overlapping region is nearly identical to that of CABP5. Thus, these two genes encode the protein products with distinct N-terminal halves but identical C-terminal halves. CABP3 inhibits calcium-dependent inactivation of L-type calcium channel and shifts voltage dependence of activation to more depolarized membrane potentials. It is also involved in the transmission of light signals.

    References
  • McCauliffe DP, et al. (1990) A human Ro/SS-A autoantigen is the homologue of calreticulin and is highly homologous with onchocercal RAL-1 antigen and an aplysia memory molecule. J Clin Invest. 86(1):332-5.
  • Beutler E, et al. (1997) HLA-H and associated proteins in patients with hemochromatosis. Mol Med. 3(6):397-402.
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Size / Price
    Catalog: HG13896-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"