CABC1/ADCK3 cDNA ORF Clone, Human, C-HA tag

Cat: HG10651-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CABC1/ADCK3 Reagents
CRO Services
Product recommended

All CABC1/ADCK3 Reagents
CABC1/ADCK3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1944 bp
Description
Full length Clone DNA of Human chaperone, ABC1 activity of bc1 complex homolog (S. pombe) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CABC1/ADCK3 cDNA ORF Clone, Human, C-HA tag Alternative Names
ARCA2 cDNA ORF Clone, Human;CABC1 cDNA ORF Clone, Human;COQ10D4 cDNA ORF Clone, Human;COQ8 cDNA ORF Clone, Human;SCAR9 cDNA ORF Clone, Human
CABC1/ADCK3 Background Information
Full Name
aarF domain containing kinase 3

CABC1/ADCK3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CABC1/ADCK3 cDNA ORF Clone in Cloning Vector, Rat RG80927-U
CABC1/ADCK3 cDNA ORF Clone, Rat, untagged RG80927-UT
CABC1/ADCK3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80927-ACGLN
CABC1/ADCK3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80927-ACG
CABC1/ADCK3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80927-ANG
CABC1/ADCK3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80927-ACR
CABC1/ADCK3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80927-ANR
CABC1/ADCK3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80927-CF
CABC1/ADCK3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80927-NF
CABC1/ADCK3 cDNA ORF Clone, Rat, C-His tag RG80927-CH
CABC1/ADCK3 cDNA ORF Clone, Rat, N-His tag RG80927-NH
CABC1/ADCK3 cDNA ORF Clone, Rat, C-HA tag RG80927-CY
CABC1/ADCK3 cDNA ORF Clone, Rat, N-HA tag RG80927-NY
CABC1/ADCK3 cDNA ORF Clone, Rat, C-Myc tag RG80927-CM
CABC1/ADCK3 cDNA ORF Clone, Rat, N-Myc tag RG80927-NM
CABC1/ADCK3 qPCR Primer Pairs, Rat RP300891

CABC1/ADCK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CABC1/ADCK3 cDNA ORF Clone in Cloning Vector, Mouse MG50849-G
CABC1/ADCK3 cDNA ORF Clone, Mouse, untagged MG50849-UT
CABC1/ADCK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50849-ACGLN
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50849-ACG
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50849-ANG
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50849-ACR
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50849-ANR
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50849-CF
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50849-NF
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-His tag MG50849-CH
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-His tag MG50849-NH
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-HA tag MG50849-CY
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-HA tag MG50849-NY
CABC1/ADCK3 cDNA ORF Clone, Mouse, C-Myc tag MG50849-CM
CABC1/ADCK3 cDNA ORF Clone, Mouse, N-Myc tag MG50849-NM
CABC1/ADCK3 qPCR Primer Pairs, Mouse MP200820

CABC1/ADCK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CABC1/ADCK3 cDNA ORF Clone in Cloning Vector, Human HG10651-M
CABC1/ADCK3 cDNA ORF Clone, Human, untagged HG10651-UT
CABC1/ADCK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10651-ACGLN
CABC1/ADCK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10651-ACG
CABC1/ADCK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10651-ANG
CABC1/ADCK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10651-ACR
CABC1/ADCK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10651-ANR
CABC1/ADCK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10651-CF
CABC1/ADCK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10651-NF
CABC1/ADCK3 cDNA ORF Clone, Human, C-His tag HG10651-CH
CABC1/ADCK3 cDNA ORF Clone, Human, N-His tag HG10651-NH
CABC1/ADCK3 cDNA ORF Clone, Human, N-HA tag HG10651-NY
CABC1/ADCK3 cDNA ORF Clone, Human, C-Myc tag HG10651-CM
CABC1/ADCK3 cDNA ORF Clone, Human, N-Myc tag HG10651-NM
CABC1/ADCK3 qPCR Primer Pairs, Human HP100623
info info
添加购物车成功! 添加购物车失败!