Quick Order

Human Carbonic Anhydrase VII Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CA7 cDNA Clone Product Information
NCBI RefSeq:BC033865
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase VII with N terminal HA tag.
Gene Synonym:CAVII, CA7
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Carbonic anhydrase 7, also known as carbonate dehydratase VII, carbonic anhydrase VII, CA-VII and CA7, is a cytoplasm protein which belongs to the alpha-carbonic anhydrase family. Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases show extensive diversity in tissue distribution and in their subcellular localization. CA7 / CA-VII is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms.

References
  • Montgomery J.C., et al., 1991, Genomics 11:835-848.
  • Temperini C., et al., 2006, Chemistry 12:7057-7066.
  • Temperini C., et al., 2007, Bioorg. Med. Chem. Lett. 17:628-635.
  • Maresca A., et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
  • Size / Price
    Catalog: HG12147-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"