Quick Order

Human CA7 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CA7 cDNA Clone Product Information
NCBI RefSeq:BC033865
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase VII with C terminal His tag.
Gene Synonym:CAVII, CA7
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Carbonic anhydrase 7, also known as carbonate dehydratase VII, carbonic anhydrase VII, CA-VII and CA7, is a cytoplasm protein which belongs to the alpha-carbonic anhydrase family. Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases show extensive diversity in tissue distribution and in their subcellular localization. CA7 / CA-VII is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms.

References
  • Montgomery J.C., et al., 1991, Genomics 11:835-848.
  • Temperini C., et al., 2006, Chemistry 12:7057-7066.
  • Temperini C., et al., 2007, Bioorg. Med. Chem. Lett. 17:628-635.
  • Maresca A., et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
  • Size / Price
    Catalog: HG12147-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"