After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CA13 cDNA Clone Product Information
NCBI RefSeq:NM_198584.2
RefSeq ORF Size:789bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal Flag tag.
Gene Synonym:CAXIII, FLJ37995, MGC59868, CA13
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10461-ACG$225
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10461-ACR$225
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10461-ANG$225
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10461-ANR$225
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10461-CF$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-His tagHG10461-CH$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10461-CM$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-HA tagHG10461-CY$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone in cloning vectorHG10461-M$75
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10461-M-F$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10461-NF$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-His tagHG10461-NH$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10461-NM$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid, N-HA tagHG10461-NY$195
Human Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmidHG10461-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"