Carbonic anhydrase II cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10478-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carbonic anhydrase II Reagents
CRO Services
Product recommended

All Carbonic anhydrase II Reagents
Carbonic anhydrase II cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
783 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 562 C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human carbonic anhydrase II with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.83kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Carbonic anhydrase II cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carbonic anhydrase II cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Carbonic Anhydrase II Gene Expression validated Image 1551
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Carbonic anhydrase II cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CA-II cDNA ORF Clone, Human;CAC cDNA ORF Clone, Human;CAII cDNA ORF Clone, Human;Car2 cDNA ORF Clone, Human;HEL-76 cDNA ORF Clone, Human;HEL-S-282 cDNA ORF Clone, Human
Carbonic anhydrase II Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

Full Name
carbonic anhydrase II
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Carbonic anhydrase II cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Ferret FG60084-G
    Carbonic anhydrase II cDNA ORF Clone, Ferret, untagged FG60084-UT
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60084-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60084-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60084-ANG
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60084-ACR
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60084-ANR
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60084-CF
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60084-NF
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-His tag FG60084-CH
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-His tag FG60084-NH
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-HA tag FG60084-CY
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-HA tag FG60084-NY
    Carbonic anhydrase II cDNA ORF Clone, Ferret, C-Myc tag FG60084-CM
    Carbonic anhydrase II cDNA ORF Clone, Ferret, N-Myc tag FG60084-NM

    Carbonic anhydrase II cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Rat RG80611-U
    Carbonic anhydrase II cDNA ORF Clone, Rat, untagged RG80611-UT
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-GFPSpark® tag RG80611-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80611-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-OFPSpark® tag RG80611-ACR
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80611-CF
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80611-NF
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-His tag RG80611-CH
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-His tag RG80611-NH
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-HA tag RG80611-CY
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-HA tag RG80611-NY
    Carbonic anhydrase II cDNA ORF Clone, Rat, C-Myc tag RG80611-CM
    Carbonic anhydrase II cDNA ORF Clone, Rat, N-Myc tag RG80611-NM
    Carbonic anhydrase II qPCR Primer Pairs, Rat RP300575

    Carbonic anhydrase II cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Mouse MG50685-G
    Carbonic anhydrase II cDNA ORF Clone, Mouse, untagged MG50685-UT
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50685-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50685-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50685-ANG
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50685-ACR
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50685-ANR
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50685-CF
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50685-NF
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-His tag MG50685-CH
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-His tag MG50685-NH
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-HA tag MG50685-CY
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-HA tag MG50685-NY
    Carbonic anhydrase II cDNA ORF Clone, Mouse, C-Myc tag MG50685-CM
    Carbonic anhydrase II cDNA ORF Clone, Mouse, N-Myc tag MG50685-NM
    Carbonic anhydrase II qPCR Primer Pairs, Mouse MP200663

    Carbonic anhydrase II cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carbonic anhydrase II cDNA ORF Clone in Cloning Vector, Human HG10478-M
    Carbonic anhydrase II cDNA ORF Clone, Human, untagged HG10478-UT
    Carbonic anhydrase II cDNA ORF Clone, Human, C-GFPSpark® tag HG10478-ACG
    Carbonic anhydrase II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10478-ACGLN
    Carbonic anhydrase II cDNA ORF Clone, Human, N-GFPSpark® tag HG10478-ANG
    Carbonic anhydrase II cDNA ORF Clone, Human, C-OFPSpark® tag HG10478-ACR
    Carbonic anhydrase II cDNA ORF Clone, Human, N-OFPSpark® tag HG10478-ANR
    Carbonic anhydrase II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10478-NF
    Carbonic anhydrase II cDNA ORF Clone, Human, C-His tag HG10478-CH
    Carbonic anhydrase II cDNA ORF Clone, Human, N-His tag HG10478-NH
    Carbonic anhydrase II cDNA ORF Clone, Human, C-HA tag HG10478-CY
    Carbonic anhydrase II cDNA ORF Clone, Human, N-HA tag HG10478-NY
    Carbonic anhydrase II cDNA ORF Clone, Human, C-Myc tag HG10478-CM
    Carbonic anhydrase II cDNA ORF Clone, Human, N-Myc tag HG10478-NM
    Carbonic anhydrase II qPCR Primer Pairs, Human HP100500
    info info
    添加购物车成功! 添加购物车失败!