Quick Order

Human Complement component 7 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human C7 cDNA Clone Product Information
NCBI RefSeq:BC063851
RefSeq ORF Size:2532bp
cDNA Description:Full length Clone DNA of Homo sapiens complement component 7 with N terminal Myc tag.
Gene Synonym:C7
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.

References
  • Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.
  • Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.
  • Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.
  • Size / Price
    Catalog: HG13848-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"