C3a Receptor cDNA ORF Clone, Human, N-His tag

Cat: HG11469-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All C3a Receptor Reagents
CRO Services
Product recommended

All C3a Receptor Reagents
C3a Receptor cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1449 bp
Description
Full length Clone DNA of Human complement component 3a receptor 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C3a Receptor cDNA ORF Clone, Human, N-His tag Alternative Names
AZ3B cDNA ORF Clone, Human;C3AR cDNA ORF Clone, Human;HNFAG09 cDNA ORF Clone, Human
C3a Receptor Background Information
Full Name
complement component 3a receptor 1

C3a Receptor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C3a Receptor cDNA ORF Clone in Cloning Vector, Mouse MG50419-M
C3a Receptor cDNA ORF Clone, Mouse, untagged MG50419-UT
C3a Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50419-ACGLN
C3a Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50419-ACG
C3a Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50419-ACR
C3a Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50419-CF
C3a Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50419-NF
C3a Receptor cDNA ORF Clone, Mouse, C-His tag MG50419-CH
C3a Receptor cDNA ORF Clone, Mouse, N-His tag MG50419-NH
C3a Receptor cDNA ORF Clone, Mouse, C-HA tag MG50419-CY
C3a Receptor cDNA ORF Clone, Mouse, N-HA tag MG50419-NY
C3a Receptor cDNA ORF Clone, Mouse, C-Myc tag MG50419-CM
C3a Receptor cDNA ORF Clone, Mouse, N-Myc tag MG50419-NM
C3a Receptor qPCR Primer Pairs, Mouse MP200431

C3a Receptor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C3a Receptor cDNA ORF Clone in Cloning Vector, Human HG11469-M
C3a Receptor cDNA ORF Clone, Human, untagged HG11469-UT
C3a Receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11469-ACGLN
C3a Receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG11469-ACG
C3a Receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG11469-ACR
C3a Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11469-CF
C3a Receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11469-NF
C3a Receptor cDNA ORF Clone, Human, C-His tag HG11469-CH
C3a Receptor cDNA ORF Clone, Human, C-HA tag HG11469-CY
C3a Receptor cDNA ORF Clone, Human, N-HA tag HG11469-NY
C3a Receptor cDNA ORF Clone, Human, C-Myc tag HG11469-CM
C3a Receptor cDNA ORF Clone, Human, N-Myc tag HG11469-NM
C3a Receptor qPCR Primer Pairs, Human HP101346
info info
添加购物车成功! 添加购物车失败!