C1GALT1C cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13363-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C1GALT1C Reagents
CRO Services
Product recommended

All C1GALT1C Reagents
C1GALT1C cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
996 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human C1GALT1-specific chaperone 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
C1GALT1C cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
More Information About C1GALT1C
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1GALT1C cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
C1GALT1C cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C1GALT2 cDNA ORF Clone, Human;C38H2-L1 cDNA ORF Clone, Human;COSMC cDNA ORF Clone, Human;HSPC067 cDNA ORF Clone, Human;MST143 cDNA ORF Clone, Human;TNPS cDNA ORF Clone, Human
C1GALT1C Background Information
Full Name
C1GALT1-specific chaperone 1

C1GALT1C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
C1GALT1C cDNA ORF Clone in Cloning Vector, Rat RG80550-U
C1GALT1C cDNA ORF Clone, Rat, untagged RG80550-UT
C1GALT1C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80550-ACGLN
C1GALT1C cDNA ORF Clone, Rat, C-GFPSpark® tag RG80550-ACG
C1GALT1C cDNA ORF Clone, Rat, C-OFPSpark® tag RG80550-ACR
C1GALT1C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80550-CF
C1GALT1C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80550-NF
C1GALT1C cDNA ORF Clone, Rat, C-His tag RG80550-CH
C1GALT1C cDNA ORF Clone, Rat, N-His tag RG80550-NH
C1GALT1C cDNA ORF Clone, Rat, C-HA tag RG80550-CY
C1GALT1C cDNA ORF Clone, Rat, N-HA tag RG80550-NY
C1GALT1C cDNA ORF Clone, Rat, C-Myc tag RG80550-CM
C1GALT1C cDNA ORF Clone, Rat, N-Myc tag RG80550-NM
C1GALT1C qPCR Primer Pairs, Rat RP300514

C1GALT1C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C1GALT1C cDNA ORF Clone in Cloning Vector, Mouse MG52191-G
C1GALT1C cDNA ORF Clone, Mouse, untagged MG52191-UT
C1GALT1C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52191-ACG
C1GALT1C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52191-ACGLN
C1GALT1C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52191-ACR
C1GALT1C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52191-CF
C1GALT1C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52191-NF
C1GALT1C cDNA ORF Clone, Mouse, C-His tag MG52191-CH
C1GALT1C cDNA ORF Clone, Mouse, N-His tag MG52191-NH
C1GALT1C cDNA ORF Clone, Mouse, C-HA tag MG52191-CY
C1GALT1C cDNA ORF Clone, Mouse, N-HA tag MG52191-NY
C1GALT1C cDNA ORF Clone, Mouse, C-Myc tag MG52191-CM
C1GALT1C cDNA ORF Clone, Mouse, N-Myc tag MG52191-NM
C1GALT1C qPCR Primer Pairs, Mouse MP202064

C1GALT1C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C1GALT1C cDNA ORF Clone in Cloning Vector, Human HG13363-G
C1GALT1C cDNA ORF Clone, Human, untagged HG13363-UT
C1GALT1C cDNA ORF Clone, Human, untagged HG19438-UT
C1GALT1C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13363-ACGLN
C1GALT1C cDNA ORF Clone, Human, C-GFPSpark® tag HG13363-ACG
C1GALT1C cDNA ORF Clone, Human, C-OFPSpark® tag HG13363-ACR
C1GALT1C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13363-NF
C1GALT1C cDNA ORF Clone, Human, C-His tag HG13363-CH
C1GALT1C cDNA ORF Clone, Human, N-His tag HG13363-NH
C1GALT1C cDNA ORF Clone, Human, C-HA tag HG13363-CY
C1GALT1C cDNA ORF Clone, Human, N-HA tag HG13363-NY
C1GALT1C cDNA ORF Clone, Human, C-Myc tag HG13363-CM
C1GALT1C cDNA ORF Clone, Human, N-Myc tag HG13363-NM
C1GALT1C qPCR Primer Pairs, Human HP102068
info info
添加购物车成功! 添加购物车失败!