VISTA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13482-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VISTA Reagents
CRO Services
Product recommended

All VISTA Reagents
VISTA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
936 bp
Description
Full length Clone DNA of Human chromosome 10 open reading frame 54 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VISTA Background Information
Full Name
V-set immunoregulatory receptor

VISTA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Rat RG81347-G

VISTA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Mouse MG51550-G
VISTA cDNA ORF Clone, Mouse, untagged MG51550-UT
VISTA cDNA ORF Clone, Mouse, untagged MG5A7629-UT
VISTA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7629-ACGLN
VISTA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51550-ACG
VISTA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51550-ACGLN
VISTA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51550-ACR
VISTA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51550-CF
VISTA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51550-NF
VISTA cDNA ORF Clone, Mouse, C-His tag MG51550-CH
VISTA cDNA ORF Clone, Mouse, N-His tag MG51550-NH
VISTA cDNA ORF Clone, Mouse, C-HA tag MG51550-CY
VISTA cDNA ORF Clone, Mouse, N-HA tag MG51550-NY
VISTA cDNA ORF Clone, Mouse, C-Myc tag MG51550-CM
VISTA cDNA ORF Clone, Mouse, N-Myc tag MG51550-NM
VISTA qPCR Primer Pairs, Mouse MP201434

VISTA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Human HG13482-G
VISTA cDNA ORF Clone, Human, untagged HG13482-UT
VISTA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13482-ACGLN
VISTA cDNA ORF Clone, Human, C-GFPSpark® tag HG13482-ACG
VISTA cDNA ORF Clone, Human, C-OFPSpark® tag HG13482-ACR
VISTA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13482-CF
VISTA cDNA ORF Clone, Human, C-His tag HG13482-CH
VISTA cDNA ORF Clone, Human, N-His tag HG13482-NH
VISTA cDNA ORF Clone, Human, C-HA tag HG13482-CY
VISTA cDNA ORF Clone, Human, N-HA tag HG13482-NY
VISTA cDNA ORF Clone, Human, C-Myc tag HG13482-CM
VISTA cDNA ORF Clone, Human, N-Myc tag HG13482-NM
VISTA qPCR Primer Pairs, Human HP102182
info info
添加购物车成功! 添加购物车失败!