Quick Order

Human VISTA/GI24/B7-H5 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human C10ORF54 cDNA Clone Product Information
NCBI RefSeq:BC020568
RefSeq ORF Size:981 bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 10 open reading frame 54 with C terminal His tag.
Gene Synonym:B7-H5,B7H5,DD1alpha,GI24,PP2135,SISP1,VISTA
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-C10ORF54-His
Restriction Site:HindIII + XbaI(6kb+0.98kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

C10orf54, also known as GI24, belongs to the immunoglobulin superfamily. It is a transmembrane molecule expressed in bone, on embryonic stem cells (ESCs), and on tumor cell surfaces. On ESCs, C10orf54 appears to positively interact with BMP-4, potentiating BMP signaling and the transition from an undifferentiated to a differentiated state. On tumor cells, C10orf54 both promotes MT1-MMP expression and activity and serves as a substrate for MT1-MMP. This increases the potential for cell motility. Human C10orf54 undergoes proteolytic cleavage by MT1-MMP, generating a soluble 30 kDa extracellular fragment plus a 25-30 kDa membrane-bound fragment.

References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • Colland F, et al. (2004) Functional proteomics mapping of a human signaling pathway. Genome Res. 14(7):1324-32.
  • Size / Price
    Catalog: HG13482-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"