Quick Order

Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human BTK cDNA Clone Product Information
NCBI RefSeq:NM_000061.2
RefSeq ORF Size:1980bp
cDNA Description:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal His tag.
Gene Synonym:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-BTK-His
Restriction Site:KpnI + NotI (6kb + 2.03kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10578-ACG$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10578-ACR$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10578-ANG$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10578-ANR$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagHG10578-CF$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tagHG10578-CH$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tagHG10578-CM$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tagHG10578-CY$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone in cloning vectorHG10578-M$75
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Flag tagHG10578-NF$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-His tagHG10578-NH$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Myc tagHG10578-NM$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-HA tagHG10578-NY$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmidHG10578-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catalog: HG10578-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"