Quick Order

Text Size:AAA

Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human BTK cDNA Clone Product Information
NCBI RefSeq:NM_000061.2
RefSeq ORF Size:1980bp
cDNA Description:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal HA tag.
Gene Synonym:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-BTK-HA
Restriction Site:KpnI+NotI (6kb+2.02kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10578-ACG$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10578-ACR$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10578-ANG$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10578-ANR$245
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Flag tagHG10578-CF$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-His tagHG10578-CH$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-Myc tagHG10578-CM$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, C-HA tagHG10578-CY$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone in cloning vectorHG10578-M$75
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Flag tagHG10578-NF$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-His tagHG10578-NH$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-Myc tagHG10578-NM$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmid, N-HA tagHG10578-NY$215
Human Bruton Tyrosine Kinase / BTK Kinase Gene ORF cDNA clone expression plasmidHG10578-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"