Biglycan cDNA ORF Clone, Human, C-His tag

Cat: HG10447-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Biglycan Reagents

CRO Services

Product recommended


All Biglycan Reagents

Biglycan cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Description
Full length Clone DNA of Human biglycan with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Biglycan cDNA ORF Clone, Human, C-His tag Alternative Names

DSPG1 cDNA ORF Clone, Human;PG-S1 cDNA ORF Clone, Human;PGI cDNA ORF Clone, Human;SLRR1A cDNA ORF Clone, Human

Biglycan Background Information

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Full Name
biglycan
References
  • Fisher L.W., et al.,(1989), Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several nonconnective tissue proteins in a variety of species. J. Biol. Chem. 264:4571-4576.
  • Fisher L.W., et al., (1991), Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization.J. Biol. Chem. 266:14371-14377.
  • Mallon A.-M., et al.,(2000), Comparative genome sequence analysis of the Bpa/Str region in mouse and man.Genome Res. 10:758-775.
  • Biglycan cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Biglycan cDNA ORF Clone in Cloning Vector, Mouse MG50766-G
    Biglycan cDNA ORF Clone, Mouse, untagged MG50766-UT
    Biglycan cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50766-ACG
    Biglycan Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50766-ACGLN
    Biglycan cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50766-ACR
    Biglycan cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50766-CF
    Biglycan cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50766-NF
    Biglycan cDNA ORF Clone, Mouse, C-His tag MG50766-CH
    Biglycan cDNA ORF Clone, Mouse, N-His tag MG50766-NH
    Biglycan cDNA ORF Clone, Mouse, C-HA tag MG50766-CY
    Biglycan cDNA ORF Clone, Mouse, N-HA tag MG50766-NY
    Biglycan cDNA ORF Clone, Mouse, C-Myc tag MG50766-CM
    Biglycan cDNA ORF Clone, Mouse, N-Myc tag MG50766-NM
    Biglycan qPCR Primer Pairs, Mouse MP200740

    Biglycan cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Biglycan cDNA ORF Clone in Cloning Vector, Human HG10447-M
    Biglycan cDNA ORF Clone, Human, untagged HG10447-UT
    Biglycan Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10447-ACGLN
    Biglycan cDNA ORF Clone, Human, C-GFPSpark® tag HG10447-ACG
    Biglycan cDNA ORF Clone, Human, C-OFPSpark® tag HG10447-ACR
    Biglycan cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10447-CF
    Biglycan cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10447-NF
    Biglycan cDNA ORF Clone, Human, N-His tag HG10447-NH
    Biglycan cDNA ORF Clone, Human, C-HA tag HG10447-CY
    Biglycan cDNA ORF Clone, Human, N-HA tag HG10447-NY
    Biglycan cDNA ORF Clone, Human, C-Myc tag HG10447-CM
    Biglycan cDNA ORF Clone, Human, N-Myc tag HG10447-NM
    Biglycan qPCR Primer Pairs, Human HP100476
    info info
    添加购物车成功! 添加购物车失败!