Biglycan cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10447-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Biglycan Reagents
CRO Services
Product recommended

All Biglycan Reagents
Biglycan cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 540C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human biglycan with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.16kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Biglycan cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Biglycan cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Biglycan Gene Expression validated Image 1544
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Biglycan cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DSPG1 cDNA ORF Clone, Human;PG-S1 cDNA ORF Clone, Human;PGI cDNA ORF Clone, Human;SLRR1A cDNA ORF Clone, Human
Biglycan Background Information

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Full Name
biglycan
References
  • Fisher L.W., et al.,(1989), Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several nonconnective tissue proteins in a variety of species. J. Biol. Chem. 264:4571-4576.
  • Fisher L.W., et al., (1991), Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization.J. Biol. Chem. 266:14371-14377.
  • Mallon A.-M., et al.,(2000), Comparative genome sequence analysis of the Bpa/Str region in mouse and man.Genome Res. 10:758-775.
  • Biglycan cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Biglycan cDNA ORF Clone in Cloning Vector, Mouse MG50766-G
    Biglycan cDNA ORF Clone, Mouse, untagged MG50766-UT
    Biglycan Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50766-ACGLN
    Biglycan cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50766-ACG
    Biglycan cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50766-ACR
    Biglycan cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50766-CF
    Biglycan cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50766-NF
    Biglycan cDNA ORF Clone, Mouse, C-His tag MG50766-CH
    Biglycan cDNA ORF Clone, Mouse, N-His tag MG50766-NH
    Biglycan cDNA ORF Clone, Mouse, C-HA tag MG50766-CY
    Biglycan cDNA ORF Clone, Mouse, N-HA tag MG50766-NY
    Biglycan cDNA ORF Clone, Mouse, C-Myc tag MG50766-CM
    Biglycan cDNA ORF Clone, Mouse, N-Myc tag MG50766-NM
    Biglycan qPCR Primer Pairs, Mouse MP200740

    Biglycan cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Biglycan cDNA ORF Clone in Cloning Vector, Human HG10447-M
    Biglycan cDNA ORF Clone, Human, untagged HG10447-UT
    Biglycan Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10447-ACGLN
    Biglycan cDNA ORF Clone, Human, C-GFPSpark® tag HG10447-ACG
    Biglycan cDNA ORF Clone, Human, C-OFPSpark® tag HG10447-ACR
    Biglycan cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10447-NF
    Biglycan cDNA ORF Clone, Human, C-His tag HG10447-CH
    Biglycan cDNA ORF Clone, Human, N-His tag HG10447-NH
    Biglycan cDNA ORF Clone, Human, C-HA tag HG10447-CY
    Biglycan cDNA ORF Clone, Human, N-HA tag HG10447-NY
    Biglycan cDNA ORF Clone, Human, C-Myc tag HG10447-CM
    Biglycan cDNA ORF Clone, Human, N-Myc tag HG10447-NM
    Biglycan qPCR Primer Pairs, Human HP100476
    info info
    添加购物车成功! 添加购物车失败!