Bcl-2 cDNA ORF Clone, Human, N-His tag

Cat: HG10195-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Bcl-2 Reagents
CRO Services
Product recommended

All Bcl-2 Reagents
Bcl-2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
720 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI (6kb + 0.77kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Bcl-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bcl-2 cDNA ORF Clone, Human, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
Bcl-2 cDNA ORF Clone, Human, N-His tag Alternative Names
Bcl-2 cDNA ORF Clone, Human;PPP1R50 cDNA ORF Clone, Human
Bcl-2 Background Information

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
B-cell CLL/lymphoma 2
References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Bcl-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Bcl-2 cDNA ORF Clone in Cloning Vector, Mouse MG53719-U
    Bcl-2 cDNA ORF Clone, Mouse, untagged MG53719-UT
    Bcl-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53719-ACG
    Bcl-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53719-ACGLN
    Bcl-2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53719-ANG
    Bcl-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53719-ACR
    Bcl-2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53719-ANR
    Bcl-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53719-CF
    Bcl-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53719-NF
    Bcl-2 cDNA ORF Clone, Mouse, C-His tag MG53719-CH
    Bcl-2 cDNA ORF Clone, Mouse, N-His tag MG53719-NH
    Bcl-2 cDNA ORF Clone, Mouse, C-HA tag MG53719-CY
    Bcl-2 cDNA ORF Clone, Mouse, N-HA tag MG53719-NY
    Bcl-2 cDNA ORF Clone, Mouse, C-Myc tag MG53719-CM
    Bcl-2 cDNA ORF Clone, Mouse, N-Myc tag MG53719-NM

    Bcl-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Bcl-2 cDNA ORF Clone in Cloning Vector, Human HG10195-M
    Bcl-2 cDNA ORF Clone, Human, untagged HG10195-UT
    Bcl-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10195-ACG
    Bcl-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10195-ACGLN
    Bcl-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10195-ANG
    Bcl-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10195-ACR
    Bcl-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10195-ANR
    Bcl-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10195-CF
    Bcl-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10195-NF
    Bcl-2 cDNA ORF Clone, Human, C-His tag HG10195-CH
    Bcl-2 cDNA ORF Clone, Human, C-HA tag HG10195-CY
    Bcl-2 cDNA ORF Clone, Human, N-HA tag HG10195-NY
    Bcl-2 cDNA ORF Clone, Human, C-Myc tag HG10195-CM
    Bcl-2 cDNA ORF Clone, Human, N-Myc tag HG10195-NM
    Bcl-2 qPCR Primer Pairs, Human HP100259
    info info
    添加购物车成功! 添加购物车失败!